Cells and viruses
HT-29 (ATCC, HTB-38), heparan-sulfate/sialic acid deficient HT-29 (HT29-DKO, ∆EXTL3 and ∆SLC35A1), A549 (ATCC, CCL-185), 293FT (Thermo Fisher, #R70007), HuTu80 (ATCC, HTB-40), Vero (ATCC, CCL-81), BHK21 (ATCC, CCL-10), and MEF cells were cultured at 37 °C with 5% CO2 in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 1× penicillin/streptomycin.
Human parechovirus PeV-A1, Harris strain (ATCC, VR-52) and PeV-A3, US/MO-KC/2014/001 (Bei resources, NR-51187) were propagated and titered on Vero cells; PeV-A2, Williamson (ATCC, VR-1820) was propagated and titered on HT29-DKO cells. The GFP-expressing HSV (K26GFP) was kindly provided by Desai and Person34. EV-A71, Taiwan/4643/98 strain, was generated from infectious clone using RD cells35. Coxsackie Virus B3 Luciferase was a generous gift from Dr. Frank van Kuppeveld.
Plasmid construction
The complementary DNA (NM_001020818.2) encoding human MYADM protein was codon-optimized and synthesized (IDT). It served as a template for a two-step PCR, where C-terminal HA-tag and vector overhangs complementary to the lentiviral vector were added using the following primers (IDT): 5’-TGTGGTGGAATTCTGCAGATACCATGCCCGTGACGGTCACACGCAC-3’, 5’-TCCGGAACATCATACGGATATACCTTAACAAAAACGAGGTGCGCAG-3’, and 5’-CGGCCGCCACTGTGCTGGATTTATGCATAATCCGGAACATCATACGGATATACCT-3’. The resulting cDNA was cloned into the lentivirus vector pLenti-CMV-Puro-Dest (w118-1) (Addgene, 17452) digested with EcoRV using Gibson Assembly. Similarly, the HA-tagged ITGB6 sequence was amplified from integrin beta6 EGFP-N3 (Addgene, 13593) using the primers (IDT): 5’-TGTGGTGGAATTCTGCAGATACCATGGGGATTGAACTGCTTTGCCTG-3’, 5’-TCCGGAACATCATACGGATAGCAATCTGTGGAAAGGTCTACCTTTTG-3’, and 5’-CGGCCGCCACTGTGCTGGATTTATGCATAATCCGGAACATCATACGGATAGCAATC-3’. The amplified sequence was then cloned into EcoRV-digested pLenti-CMV-Puro-Dest (w118-1).
The complementary DNAs encoding HA-tagged MYADM of other mammalian species, including Mus musculus (NM_001093764.1), Equus caballus (XM_023650340.1), Canis lupus familiaris (XM_003638804.3), Felis catus (XM_003997448.6), Mesocricetus auratus (XM_005084151.4), Macaca fascicularis (XM_005590268.3), Capra hircus (XM_018063034.1), Bos taurus (XM_027514819.1), and Mustela putorius furo (XM_013049591.2), were synthesized as gene fragments (IDT and Twist Bioscience). The gene fragments were synthesized with lentiviral vector overhangs, specifically 5’-TGTGGTGGAATTCTGCAGATACC - MYADM-HA cDNA sequences - ATCCAGCACAGTGGCGGCCG-3’, and cloned into pLenti-CMV-Puro-Dest (w118-1) as described above. Additionally, ectodomain swapped constructs of the human_MYADM and hamster_MYADM were also synthesized and cloned using similar procedures.
To generate lentiviral constructs expressing the human MYADM with amino acid mutants corresponding to house MYADM, pLenti-CMV-Puro-MYADM-HA was used as a template and mutations were introduced by PCR using primers pairs containing the respective mutations and a 20 bp overlap for Gibson Assembly. The primers used for the mutant constructs are as follows (IDT): 6AA-EHNTHD: 5’-TTCAACATCACATGCCCACTACGTTTGCGACTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTGGGCATGTGATGTTGAACAATTATGTTCCCGTGATCGTCGGGGTTGCCCTCC-3’; 3AA-EHN: 5’-CGATCACGGGAACATAATTGTTCAAGATCACATGCCTACTACGTTTGC-3’ and 5’-CAATTATGTTCCCGTGATCGTCGGGGTTGCCCTC-3’; 3AA-THD: 5’-TTCAACATCACATGCCCACTACGTTTGCGACTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTGGGCATGTGATGTTGAACAAGATACGTCCCGTGATCGTCGG-3’; 2AA-EH: 5’-TTCAAGATCACATGCCTACTACGTTTGCGCCTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTAGGCATGTGATCTTGAACAAGAATGTTCCCGTGATCGTCGGGGTTGCCCTCC-3’; 2AA-EN: 5’-TTCAAGATCACATGCCTACTACGTTTGCGCCTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTAGGCATGTGATCTTGAACAATTTACTTCCCGTGATCGTCGGGGTTGCCCTCC-3’; 2AA-HN: 5’-TTCAAGATCACATGCCTACTACGTTTGCGCCTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTAGGCATGTGATCTTGAACAATTATGGTCCCGTGATCGTCGGGGTTGCCCTCC-3’; 1AA-E: 5’-TTCAAGATCACATGCCTACTACGTTTGCGCCTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTAGGCATGTGATCTTGAACAAGATACtTCCCGTGATCGTCGGGGTTGCCCTCC-3’; 1AA-H: 5’-TTCAAGATCACATGCCTACTACGTTTGCGCCTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTAGGCATGTGATCTTGAACAAGAATGGTCCCGTGATCGTCGGGGTTGCCCTCC-3’; 1AA-N: 5’-TTCAAGATCACATGCCTACTACGTTTGCGCCTGGGACCGGCGGCTTGCGGTGGC-3’ and 5’-AGTAGGCATGTGATCTTGAACAATTTACGTCCCGTGATCGTCGGGGTTGCCCTCC-3’. Likewise, the human MYADM mutations were introduced into the pLenti-CMV-Puro-horse-MYADM-HA construct by PCR using the following primer pairs (IDT): 3AA-DVS: 5’-CTCAACATCACATGCGCACTATGTATGCGACTGGGACCGACGGCTCGCTGTGGC-3’ and 5’-AGTGCGCATGTGATGTTGAGCAAGATACGTCCCGAGAGCGGCGCGGCTGTCCGCCG-3’; 3AA-RYA: 5’-CTCAAGATCACATGCGtACTATGTATGCGcCTGGGACCGACGGCTCGCTGTGGC-3’ and 5’-AGTACGCATGTGATcTTGAGCAATTATGTTCCCGAGAGCGGCGCGGCTGTC-3’; 1AA-V: 5’-CTCAACATCACATGCGCACTATGTATGCGACTGGGACCGACGGCTCGCTGTGGC-3’ and 5’-AGTGCGCATGTGATGTTGAGCAATTTACTTCCCGAGAGCGGCGCGGCTGTCCGCCG-3’.
Generation of heparan-sulfate/sialic acid deficient HT-29 cell line
The HT29-DKO cell line was generated through a sequential knockout of SLC35A1 and EXTL3 genes of HT-29 (ATCC, HTB-38) cells. To obtain single clonal SLC35A1 knockout HT-29 cells, the pX458 vector (Addgene, #48138) expressing Cas9 and small guide RNA (sgRNA) against SLC35A1 (SLC35A1-sgRNA: TATAACTTCTGTGATACACA) was utilized. GFP-positive single cells were sorted 48 h post-transfection using BD Aria II into 96-well plates and screened for knockout by Sanger sequencing using primers 5’-TGCACGCTCATGTAATTGGC-3’ and 5’-GTAGCATCTCTCAAGTTGTGAC-3’ (IDT). To generate SLC35A1 and EXTL3 double knockout cells, SLC35A1 knockout cells were transfected with pX458 vector encoding sgRNA against EXTL3 (EXTL3-sgRNA, AAATGAACCTCGGTAACACG). Similarly, GFP-positive cells were single-cell sorted and screened for knockout using Sanger sequencing with primers 5’-GCTGAAGCTCTCCACCTTCG-3’ and 5’-AGGTATCTGGGTGAGGCGTAG-3’ (IDT). The selected clone was further validated through Western blot analysis using an EXTL3-specific antibody (1:1000, Santa Cruz Biotechnology, clone G-5, sc-271986) and immunofluorescence staining using Rhodamine labeled Peanut agglutinin (Vector Laboratories, RL-1072) and an antibody against heparan sulfate (Amsbio, clone F58-10E4, 370255-S).
CRISPR-Cas9 screen and data analysis
The CRISPR screens were performed using the heparan-sulfate/sialic acid deficient HT-29 cell line as previously described36. In brief, HT29-DKO cells were stably transduced with lentiCas9-Blast (Addgene, #52962) and selected using blasticidin. Subsequently, HT29-DKO-Cas9 cells were transduced with packaged sgRNA lentivirus of the Brunello library at an MOI of 0.3. After selection with puromycin, cells were pooled and expanded. Approximately 100 million mutagenized cells, constituting over 1000× sgRNA coverage, were inoculated with PeV-A1 and PeV-A2 at MOI of 0.1 and incubated until over 95% of the cells were dead. The medium was changed and the remaining live cells grew to form colonies. The unselected starting population was used as an uninfected reference. Genomic DNA was extracted from the control cells and virus-resistant cells using QIAamp DNA Mini Kit (Qiagen). The sgRNAs were amplified and subjected to next-generation sequencing using an Illumina HiSeq Lane via Novogene. The sgRNA sequences were analyzed with the MAGeCK algorithm37. The FASTQ files for CRISPR screens generated in this study have been deposited in ArrayExpress under accession code E-MTAB-13894. The Mageck analysis of the CRISPR screens are provided as Supplementary Data1.
Generation of CRISPR-Cas9-mediated knockout cell lines
Guide RNA sequences for CRISPR editing were extracted from the Brunello library and synthesized with IDT: MYADM-sgRNA (CTCCACGATGAGGATGATCA) and ITGB6-sgRNA (CCAGACTGAGGACTACCCGG) were cloned into pX458 (Addgene, #48138) to generate clonal knockout cell lines. Cells were transfected with pX458 constructs using Mirus TransLT1 Transfection Reagent (Mirus, MIR2300) and single-cell sorted based on GFP expression into 96-well plates using the BD influx cell sorter two days post transfection. Clones were expanded and screened by sequencing analysis. Genotyping was performed by extracting genomic DNA from the cells using QuickExtract DNA Extraction Solution (Lucigen), PCR amplifying a 500-700-base pair (bp) region encompassing the sgRNA-targeted site, and then Sanger sequencing the amplicons with a nested sequencing primer. The sequencing results were analyzed using the SYNTHEGO ICE analysis tool.
The primer sequences used for genotyping were as follows (IDT): MYADM-F: 5’-GCACCACCATCACAACCACC-3’ and MYADM-R: 5’-GCTAGGATGAAGCAGATGGCGTAC-3’, MYADM-seq: 5’-CAGCTGGTGTCTACCTGC-3’; ITGB6-F: 5’-CCTCCAATAGTTCTAAACTCACTG-3’ and ITGB6-R: 5’-CCTCACCTCCACTCTAAGCAAC-3’, ITGB6-seq: 5’-GCCTCTGAGAGAACTGCTG-3’.
Lentivirus production and transduction
Heterogeneous stable cell lines for gene expression or knockout were generated using lentiviral transduction. Lentivirus stocks were produced in 293FT cells by co-transfection of the interested plasmid and packaging plasmids ∆VPR, VSV-G and pAdvantage using TransIT-LT1 Transfection Reagent. One day post transfection, the transfection medium was replaced by pre-warmed DMEM culture medium. The medium containing lentivirus was harvested at 24 h and 48 h, filtered using 0.45-micron syringe filters, and stored at −80 °C.
For lentiviral transduction, target cells were seeded at 3 × 105 cells/well in a 6-well plate, with an addition well as a no transduction control. The lentivirus solution (2–4 ml per well) was added the following day, supplemented with protamine sulfate at a final concentration of 8 µg/mL, and cells were incubated at 37 °C. Approximately 48 h post transduction, cells were trypsinized, transferred to a T75 flask, and selected with puromycin at the following concentrations: HT29-DKO (1 μg/mL), HuTu80 (0.4 µg/mL), 293FT (2 μg/mL), A549 (1.5 µg/mL), MEF (5 μg/mL), Vero (6 µg/mL).
Construction of PeV-A1 infectious clone and reporter virus constructs
HT29-DKO cells were seeded in a 6-well plate and infected with PeV-A1. Viral RNA was extracted from the culture medium of virus-infected cells using QIAamp Viral RNA Mini Kit (Qiagen) and reverse transcribed with SuperScript III First-Strand Synthesis System (Invitrogen). Three overlapping fragments covering the full-length PeV-A1 genome were amplified from cDNA, and a backbone containing a T7 promoter was PCR-amplified from pD2/IC-30P38. These four fragments (F1-F4) were assembled using the Gibson Assembly Master Mix (New England Biolabs). The clones were screened by colony PCR and confirmed by whole-plasmid sequencing (Primordium Labs). Primers used for viral genome and backbone amplification were as follows (IDT): PeV-A1-F1: 5’- TTAATACGACTCACTATAGGTTTGAAAGGGGTCTCCTAGAGAGCTTG-3’ and 5’-AGTGACAACTGGTTTAGGTTCATATACTACC-3’; PeV-A1-F2: 5’-AACCTAAACCAGTTGTCACTTATGATTCAAAACTG-3’ and 5’-TCTAGTTGGTACACATGGTCTCCAAC-3’; PeV-A1-F3: 5’-GACCATGTGTACCAACTAGATTCAGATGAC-3’ and 5’-TCGATAAGCTTGCCTGCAGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATGTCCAATGTTCCAAGTTAGTGTC-3’; F4 (backbone): 5’-CCTGCAGGCAAGCTTATCGATGATAAG-3’ and 5’-CCTATAGTGAGTCGTATTAAATTTACGCGTGAG-3’.
The PeV-A1 infectious clone, designated pD2/IC-PeV-A1, was used to generate reporter virus constructs. A mNeon or NanoLuc reporter gene and a porcine teschovirus (P2A) cleavage site were introduced between PeV-A1 5’ UTR and the start codon of the polyprotein. The reporter gene and partial viral genome were synthesized (IDT) and inserted into pD2/IC-PeV-A1 between the KpnI and AvrII restriction enzyme sites using Gibson Assembly.
To produce PeV-A1-mNeon/nLuc reporter viruses, the constructs were linearized with SbfI and in vitro transcribed with MEGAscript T7 Transcription Kit (Invitrogen). The viral RNA was then subjected to DNase digestion and purified using Lithium Chloride precipitation. Vero cells (2 × 106 cells) were washed twice with PBS, mixed with purified viral RNA (5 µg) in electroporation buffer (Teknova, E0399), and electroporated using Bio-Rad Gene Pulser Xcell electroporator with the square wave protocol. The electroporated cells were resuspended in cell culture medium and transferred into a T175 flask for virus propagation. Both cells and supernatant were harvested when over 80% cell death was observed and separated by centrifugation at 600 × g for 10 min at 4 °C. The cell pellets were subjected to three freeze-thaw cycles to disrupt the cells, followed by centrifugation to remove cellular debris. The resulting supernatant was combined with the original supernatant, filtered through a 0.22 μm filter, and stored at −80 °C as aliquots.
Quantification of virus infection in cell lines
qPCR infectivity assays
Cells were plated in 96-well plates in triplicates and infected with viruses at an MOI of 0.1. Cells were collected and processed at 48 h post infection using Power SYBR Green Cells-to-CT Kit (ThermoFisher, #4402954) following the manufacturer’s instructions. All samples were normalized to 18S expression. The following qPCR primers were used (IDT): PeV-A1-3-F: 5’-ACGAAGGATGCCCAGAAGGTAC-3’, PeV-A1-3-R: 5’-AGGGATCCCCCCTGGGTTTG-3’; 18S-F: 5′-AGAAACGGCTACCACATCCA-3′, 18S-R: 5′-CACCAGACTTGCCCTCCA-3′.
Luciferase reporter virus assays
Cells were seeded in triplicates in 96-well plates, infected with reporter virus at an MOI of 0.1 or 1, and incubated at 37 °C with 5% CO2. Luciferase activity was measured at the indicated time points using Nano-Glo Luciferase Assay System (Promega, N1120) or Renilla Luciferase Assay System (Promega, E2810), and immediate luciferase readings were taken using a Glomax luminometer.
GFP reporter virus incucyte analysis
Cells were seeded in 96-well plates in triplicates and infected with PeV-A1-GFP reporter virus at MOI of 0.1 or 1. Individual wells were imaged over time at 4× magnification using an Incucyte System (Sartorius) in a 37 °C, 5% CO2 incubator. Virus infection was tracked by GFP fluorescence, and the number of GFP-positive foci per image was counted using Incucyte Analysis Software.
Crystal violet staining
HT29-DKO cell lines were seeded in a 24-well plate one day before infection. The following day, cells were infected with PeV-A1 at an MOI of 0.5 and incubated at 37 °C. After 72 h, cells were washed with 1× PBS, fixed with 4% PFA in 1× PBS, and stained with crystal violet staining solution (0.5% crystal violet, 20% methanol in H2O).
Construction of PeV-A1 replicon and replicon assays
The PeV-A1 replicon was constructed by deleting a total of 1161 bp from the VP3 and VP1 sequences. The PeV-A1-nLuc served as a template and was PCR-amplified into two fragments (F1 and F2) with 20 bp overlap at both ends by Phusion High-Fidelity DNA Polymerase (ThermoFisher, F530L) and the following primer pairs (IDT): F1 (4522 bp, 5’-CTGGTGCTCAATCAGTGGCTCCCTTCTTGACTGGAACCTCTACTGG-3’ and 5’-TCGATAAGCTTGCCTGCAGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATGTCCAATGTTCCAAGTTAGTGTC-3’) and F2 (5332 bp, 5’-CCTGCAGGCAAGCTTATCGATGATAAG-3’ and 5’-AGCCACTGATTGAGCACCAGTTGTACAAAG-3’). The fragments were assembled using Gibson Assembly, and the clones were confirmed by whole-plasmid sequencing.
To generate replicon RNA, the construct was linearized with SbfI, in vitro transcribed using MEGAscript T7 Transcription Kit (Invitrogen), and purified using Lithium Chloride precipitation. Two million cells were washed twice with PBS and resuspended in electroporation buffer (Teknova, E0399) containing 5 µg of replicon RNA. The mixture was transferred into a Gene Pulser Electroporation Cuvette (Bio-rad, 1652089), and electroporation was performed using the square wave protocol. The electroporated cells were resuspended in cell culture medium and aliquoted at 2 × 104 cells per well into a 96-well plate, with three replicates for each cell line. Cells were lysed at the indicated time points, and luciferase activity was measured using Nano-Glo Luciferase Assay System (Promega, N1120) and a Glomax luminometer.
Virus binding and internalization assays
The assays were conducted following the methods described previously with slight modification39. Briefly, A549 cell lines were plated in 12-well plates with three replicates each, one day prior to infection. PeV-A1 (MOI of 1) was added to the pre-chilled cells and incubated on ice for 1 h. Unbound virus particles were removed by washing the cells 6 times with ice-cold PBS supplemented with 2% bovine serum albumin (BSA). For virus binding assay, cells were lysed directly in the plate after the washes by adding 350 µl RLT plus buffer with β-mercaptoethanol and collected for RNA extraction using a RNeasy Plus Mini Kit (Qiagen). For internalization assay, after 6 washes with ice-cold PBS and 2% BSA, pre-warmed DMEM medium supplemented with 2% FBS was added to cells. Cells were incubated at 37 °C for 1 h for virus internalization. Cells were then chilled on ice and incubated with 500 ng/mL proteinase K in PBS at 4 °C for 2 h to remove residual surface-bound virus particles. Cells were lysed and collected for RNA extraction after 6 additional washes with ice-cold PBS and 2% BSA as described above. The qRT-PCR was performed using iScript™ Reverse Transcription Supermix (Bio-Rad) and SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) following the manufacturer’s manual. The same qPCR primer sets of PeV-A1-3 and 18S were used as those listed in the qPCR infectivity assay.
Western blot analysis
To detect the endogenous MYADM, cells were collected by scraping from 10-cm dishes and lysed in 500 μL lysis buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, and 1× Halt protease inhibitor). The lysates were passed through a 22 G needle and the insoluble materials containing the detergent-resistant membranes (DRMs) were collected by centrifugation at full speed for 15 min at 4 °C. The pellets were resuspended in 40 μL of lysis buffer supplemented with 60 mM octyl-glucoside and incubated at 37 °C for 30 min to solubilize the DRMs. The supernatants were collected by centrifugation and mixed with 4× Laemmli Sample Buffer (Bio-rad, 1610747) supplemented with β-mercaptoethanol for Western blot analysis. Protein samples were then separated by SDS-PAGE on 4–15% Mini-PROTEAN TGX Precast Gels (Bio-Rad, 4561084) and transferred onto PVDF membranes. PVDF membranes were blocked for 1 h in 5% non-fat milk in PBS containing 0.1% Tween-20 (PBST). Subsequently, membranes were incubated at 4 °C overnight with MYADM antibody (1:500; mAb 2B12)13 diluted in blocking buffer. After washing three times with PBST, membranes were incubated with goat anti-mouse IgG antibody (1:5000; GeneTex, GTX213111-01) for 1 h at room temperature. For loading controls, membranes were incubated with HRP-conjugated GAPDH antibody (1:5000; GTX627408-01) for 1 h at room temperature. Membranes were subjected to SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher, 34580) after PBST washes and visualized with a Bio-Rad ChemiDoc Touch Imaging System.
To detect the expression of HA-tagged MYADM proteins in lentiviral transduced cell lines, two million cells were lysed with 300 μL lysis buffer (100 mM Tris-HCl, pH 8.0 and 1% SDS) and incubated at 98 °C for 15 min. HA Tag Polyclonal Antibody (1:1000; ThermoFisher, 14-6756-81) and goat anti-rabbit IgG antibody (1:5000; GeneTex, GTX213110-01) were used for detection.
Generation of Flag-tagged PeV-A1 virus particles
The Flag-tagged PeV-A1 virus construct was generated by using pD2/IC-PeV-A1 as the cloning template. Through PCR, the virus construct was fragmented into three segments with at least a 20 bp overlap, while also introducing the Flag-tag sequence into the structural protein VP1. The primers used were as follows (IDT): 5’-GATTACAAGGATGACGACGATAAGAACCTTACAAATCAGAGTCCATATGGTCAAC-3’ and 5’-TCGATAAGCTTGCCTGCAGGttttttttttttttttttttttttttttttGTCATGTCCAATGTTCCAAGTTAGTGTC-3’; 5’-TTAATACGACTCACTATAGGTTTGAAAGGGGTCTCCTAGAGAGCTTG-3’ and 5’-CTTATCGTCGTCATCCTTGTAATCTGCCATATCACCCCGTAGTGCACGAC-3’; 5’-CCTGCAGGCAAGCTTATCGATGATAAG-3’ and 5’-CCTATAGTGAGTCGTATTAAATTTACGCGTGAG-3’. The three fragments were then assembled by Gibson Assembly.
PeV-A1-Flag viruses were propagated using the same procedures outlined to produce the mNeon/nLuc reporter viruses as described above. To validate the infectivity of the Flag-tagged PeV-A1 virus particles, the PeV-A1-Flag viruses were passaged three additional times on Vero cells. The infected cells were collected for RT-PCR and Western blot analysis. For RT-PCR, RNA was extracted from Vero cells using the RNeasy Plus Mini Kit (Qiagen) and then reverse transcribed into cDNA using iScript™ Reverse Transcription Supermix (Bio-Rad). To assess the stability of the Flag-tag insertion, primers that flank the Flag-tag region were utilized (IDT): 5’-TGGTTATTTGATGTGCAAGCCCTTC-3’ and 5’-TCTAGTTGGTACACATGGTCTCCAAC-3’, which yield a fragment size of 294 bp or 270 bp with or without the Flag-tag insertion.
Virus particles co-immunoprecipitation
Virus propagation and concentration
Vero cells were infected with either PeV-A1 or PeV-A1-Flag and RD cells were infected with EV-A71 at a MOI of 0.1. After 2 days post infection, both cells and supernatant were harvested and separated by centrifugation at 600 × g for 10 min at 4 °C. The cell pellets were then subjected to three freeze-thaw cycles, followed by centrifugation to remove any cellular debris. The resulting supernatant was combined with the original supernatant, filtered through a 0.22 μm filter, and subjected to ultracentrifugation at 320,000 × g for 4 h at 4 °C over a sucrose cushion. The pellets containing the viral particles were resuspended in PBS, and the insoluble material was removed by centrifugation at 16,000 × g for 10 min at 4 °C. The supernatant was further clarified with a Zeba Spin Desalting Column (Thermo Fisher Scientific).
pH dependent binding assay
Fifteen million cells per cell line (Vero cells, Vero cells expressing human MYADM-HA or MYADM-3AA-EHN-HA) were seeded in a 15-cm dish and lysed in ice-cold lysis buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 60 mM octyl-glucoside, and 1× Halt protease inhibitor). The cells were disrupted using a Dounce hom*ogenizer and incubated on ice for 30 min. The lysates were centrifuged at 16,000 × g for 20 min at 4 °C and the resulting supernatant was subjected to immunoprecipitation using Pierce Anti-HA Magnetic Beads (ThermoFisher, 88836). Beads were incubated with the lysates for 3 h at 4 °C, washed three times with the lysis buffer, and resuspended in 800 μL PBS.
To test potential binding of MYADM with concentrated virus particles, virus was added to NETN buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40) adjusted to pH 7.4, 6.5, 6.0 or 5.5 and supplemented with 1× Halt protease inhibitor. The HA beads were aliquoted into four tubes, resuspended in NETN buffer containing approximately 2 × 107 PFU virus at the respective pH values, and incubated at 4 °C for 2 h. After incubation beads were washed with NETN buffer adjusted to the respective pH. One third of the beads was subjected for RNA extraction using Trizol reagent (Invitrogen, 15596018) following the manufacturer’s protocol. The RT-qPCR was performed using iScript™ Reverse Transcription Supermix (Bio-Rad) and SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) using the primers listed above. The remaining beads were resuspended in 4× Laemmli Sample Buffer (Bio-rad, 1610737) supplemented with β-mercaptoethanol and incubated at 98 °C for 5 min for Western blot analysis. HA Tag Polyclonal Antibody (1:1000; ThermoFisher, 14-6756-81), Flag Tag Antibody (1:1000; Cell Signaling Technology, 2368S) and goat anti-rabbit IgG antibody (1:5000; GeneTex, GTX213110-01) were used for detection.
Time point binding assay
Six million cells were plated in a 10-cm dish for each condition and infected with purified PeV-A1 or EV-A71 at an MOI of 1. The infection was carried out on ice for 1 h followed by washing three times with ice-cold PBS. The cells were further incubated at 37 °C for 0, 15 or 30 min. After three subsequent washes with PBS, the cells were lysed using ice-cold lysis buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 60 mM octyl-glucoside, and 1× Halt protease inhibitor) and dounce lysed. The lysates were then centrifuged, and the soluble fractions were subjected to immunoprecipitation using anti-HA magnetic beads. The beads were washed with the lysis buffer and subsequently resuspended in Trizol reagent for RNA extraction and then qRT-PCR as described above.
Protein alignment and phylogenetic analysis
The full length MYADM protein sequences of various mammalian species, hom*o sapiens (NP_001018654.1), Mus musculus (NP_001087233.1), Equus caballus (XP_023506108.1), Canis lupus familiaris (XP_003638852.1), Felis catus (XP_003997497.1), Mesocricetus auratus (XP_005084208.1), Macaca fascicularis (XP_005590325.1), Capra hircus (XP_017918523.1), Bos taurus (XP_027370620.1), and Mustela putorius furo (XP_012905045.1), were used for the alignment (https://www.genome.jp/tools-bin/clustalw) and for the construction of the cladogram (http://phylogeny.lirmm.fr/phylo_cgi/index.cgi)40.
Fluorescent In Situ Hybridization (FISH) assay
Cells were seeded on 8-well chamber slides. For virus binding assay, cells were incubated on ice with PeV-A1 (MOI 100) for 1 h, and the unbound virus was removed by washing with cold PBS. For virus internalization, cells were then incubated with pre-warmed media for 30 min at 37 °C. FISH was performed using the ViewRNA ISH Cell Plus Assay (ThermoFisher) according to the manufacturer’s instructions. PeV-A1 RNA was detected using customized PeV-A1 specific probes (Alexa Fluor 546, ThermoFisher). Following RNA labeling, cells were stained with Wheat Germ Agglutinin (Alexa Fluor 488, Invitrogen) and Hoechst for 10 min at room temperature. Subsequently, cells were washed with PBS and mounted using Vectashield mounting medium (Vector Laboratories, H-1000). Images were acquired with an inverted confocal microscope (Zeiss LSM 800) and processed with ZEN software (Zeiss). Image analysis was performed with the FIJI software.
Human colonoid cultivation
Colon organoids were derived from de-identified, surgically obtained human gastrointestinal tissue as described previously22 by the lab of Calvin Kuo at Stanford University. Tissues were obtained through the Stanford Tissue Bank with patient consent and approval from the Stanford University Institutional Review Board. Age and sex of the patients were not collected, and samples were taken without a particular targeted or planned enrollment22.
Colonoids were maintained and passaged as previously described with slight modification22. In brief, colonoids were embedded in Cultrex Reduced Growth Factor Basem*nt Membrane Matrix, Type II (BME) and seeded into a 24-well tissue culture plate in a 30 μL droplet per well. BME was polymerized by incubating at 37 °C for 10 min. Then, 400 μL growth medium, which contains Advanced Dulbecco’s modified Eagle medium/F12, 50 ng/mL EGF, 10 mM nicotinamide, 10 nM Gastrin, 500 nM A83-01, 10 μM SB202190, 1× B27, 1 mM HEPES, 1 mM N-acetyl-cysteine, 1× Glutamax, and 50% L-WRN-conditioned medium (contains Wnt3a, R-spondin 3 and Noggin), supplemented with 10 μM Y-27632 was added on top of the BME. L-WRN-conditioned medium was generated from L-WRN cells (ATCC, CRL-3276) following a previous description41. Growth media was replaced every 2–4 days. Colonoids were passaged every 6–10 days by digesting in TrypLE Express for 10 min at 37 °C and dissociated into single cells by pipetting. Cells were counted, reseeded into fresh BME at a concentration of 2.0 × 104 cells per well, and plated in 24-well plates.
Generation of human colonoid MYADM knockout lines
Gene knockout in human colonoid was achieved using the CRISPR-Cas9 system, following a published protocol42 with some modifications. Briefly, MYADM-sgRNA was cloned into lentiCRISPRv2 (Addgene, #52961), and the plasmid was used for lentivirus production. Lentivirus solution was collected and concentrated using PEG-itTM Virus Precipitation Solution (System Biosciences) following the manual. The virus pellet was then resuspended in 600 µL CMGF(-) medium that consists of Advanced DMEM/F12 medium supplemented with 100 U/mL penicillin-streptomycin, 10 mM HEPES buffer and 1× Glutamax and stored at −80 °C.
Lentivirus transduction
Colonoid cultures were maintained and passaged in BME matrix as described above. In a 24-well plate, one well of colonoid was digested in TrypLE Express for 5 min at 37 °C, and then CMGF(-) medium with 10% FBS was added to neutralize the trypsin. The digested colonoids were fully dispersed into single cells by pipetting 50 times. The cells were washed by CMGF(-) medium, aliquoted into two tubes, and pelleted for lentiviral transduction. Lentiviral mixture containing 300 µl of concentrated lentivirus, 10 μM Y-27632, and 8 μL of polybrene (10 mM stock) was prepared and transferred to a tube containing the digested colonoids. For the control tube, 300 µL of CMGF(-) with Y-27632 and polybrene was added. Cells were resuspended by pipetting and then transferred from each tube to a well of a 48-well plate. The 48-well plate was incubated at 37 °C for 5 min, sealed with parafilm, and spin-inoculated at 300 g for 1 h at room temperature. The supernatant was then carefully removed and the cell layer in each well was resuspended with 500 µL of ice-cold CMGF(-) medium and transferred to a new microtube. Cells were pelleted and embedded into BME matrix and seeded into three wells in a 24-well plate. The BME matrix was solidified by incubating at 37 °C for 10 min, and growth medium containing 10 μM Y-27632 was added to each well.
Recovery and selection
After transduction, colonoids were allowed to recover for 6 days by changing the growth medium every other day, and then selected with 2 μg/mL puromycin. Colonoids were passaged every 7–10 days with the selection for three weeks. After the selection, the colonoids were passaged and expanded into multiple wells without puromycin.
Single-cell cloning
Colonoids were digested with TrypLE Express following the same procedures used during transduction. Additionally, the cells were filtered twice through a 70 μm cell strainer to retain single cells. On day 2 after passaging, one well of colonoids was collected in ice-cold 1× PBS and resuspended in 30 μL BME. Clonal MYADM knockout colonoid lines were obtained by limiting dilution. To ensure proper dilution, three additional 1:50 serial dilutions of the BME cell suspensions were tested by inoculating 3 μL per well into a 96-well plate. The dilution resulting in a single colonoid per well was used to plate four 96-well plates. Single clones were visually examined using bright-field microscopy, labeled, and medium was changed every 3 days.
Single colonoid clone passaging and genotyping
Single-cell-derived colonoids were passaged after 2–3 weeks using TrypLE Express. Each dissociated clones were resuspended with 60 μL of BME and inoculated into four wells in a 48-well plate. After 1–2 weeks of incubation, one well of each clone was sacrificed for validation. Cells were collected as described for passaging but were resuspended in QuickExtract DNA Extraction Solution for genomic DNA extraction. The genotyping method is referring to that used for the clonal knockout cell lines.
Virus infection in human colonoids
After 7–10 days of growth colonoids were removed from the BME matrix for polarity reversal to expose the apical surfaces22. Matrix-embedded colonoids were dislodged from the 24-well plate by adding 500 μL ice-cold 5 mM EDTA in PBS to each well. The number of wells was determined by dividing the dissociated colonoids from one well into three wells for experimental treatment. The solution from up to four wells was transferred into a 15-mL conical tube containing 10–12 mL of ice-cold 5 mM EDTA in PBS. The conical tubes were incubated on a rotary shaker at 4 °C for 1 h. Subsequently, colonoids were pelleted by centrifuging in a swinging bucket rotor at 300 × g for 3 min at 4 °C, washed with 5 mL DMEM.
Virus infection of human colonoids
Colonoids were resuspended in growth medium containing 10 μM Y-27632 with or without 10% BME matrigel for apical-out or basal-out colonoids. The suspension culture was aliquoted with 400 μL per well into 24-well ultra-low-attachment plates, and incubated for 1 day in a 37 °C, 5% CO2 incubator.
Colonoids were infected with approximately 5 × 104 PFU of PeV-A1, PeV-A2, and K26GFP per well. The inoculum was removed after 1 h post infection by transferring colonoids in suspension to 1.5 mL LoBind microcentrifuge tubes. The colonoids were collected by centrifuging at 300 × g for 3 min at 4 °C, washed once with DMEM, and transferred to a new 24-well ultra-low-attachment plate in 400 μL of growth medium with 10 μM Y-27632.
Immunofluorescence
Colonoids were collected at 48 h post infection, fixed in 2% paraformaldehyde fixative solution for 30 min at room temperature, and washed with PBS. For PeV-A1 infected samples, colonoids were incubated with Anti-dsRNA Antibody, clone rJ2 (1:100; Sigma-Aldrich, MABE1134) in blocking/permeabilization buffer (3% bovine serum albumin, 1% saponin, 1% Triton X-100 and 0.02% sodium azide in PBS) overnight at room temperature and washed with PBS. Subsequently, the colonoids were incubated with Alexa Fluor 488 Goat anti-Mouse secondary antibody (1:500; ThermoFisher, A-11001), Alexa Fluor 594 phalloidin (ThermoFisher, A12381), and 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; 1:500) in blocking/permeabilization buffer for 4 h at room temperature. In the case of K26GFP infected colonoids, they were incubated with Alexa Fluor 488 anti-GFP polyclonal antibody (ThermoFisher, A-21311), Alexa Fluor 594 phalloidin, and DAPI in blocking/permeabilization buffer for 4 h at room temperature. Stained colonoids were washed with PBS and mounted onto glass slides using Vectashield mounting medium (Vector Laboratories, H-1000), and glass coverslips were affixed using vacuum grease. Organoids were imaged on a LSM 700 confocal microscope (Carl Zeiss) at a 20x magnification.
qPCR quantification
Colonoids were collected by centrifuging at the indicated time points. RNA extraction was performed using the RNeasy Micro Kit (Qiagen, 74004), and reverse transcription was carried out using iScript™ Reverse Transcription Supermix (Bio-Rad) following the manufacturer’s instructions. qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) as described above using the qPCR primer pairs of PeV-A1-3, 18S, and HSV (HSV-UL44-F: 5′-GAGGAGGTCCTGACGAACATCACC-3’, HSV-UL44-R: 5′-CCGGTGACAGAATACAACGGAGG-3’).
Plaque assay
Growth medium from virus-infected samples at the indicated hours post infection was collected by centrifugation. Vero cell monolayers were seeded over 80% confluency in 24-well plates one day before infection. Serially diluted virus supernatants were added to cells and incubated for 1 h at 37 °C in 5% CO2. The inoculum was then removed, and the cells were overlaid with 3 ml of 1.2% Avicel/DMEM overlay medium per well. The plates were further incubated at 37 °C in 5% CO2. The overlays were removed by aspiration, and cells were washed with PBS. Cells were then fixed with 4% paraformaldehyde in PBS for at least 30 min and stained with crystal violet staining solution.
Statistics and reproducibility
One-way or two-way analysis of variance (ANOVA) with Sidak’s multiple comparison tests, or two-sided unpaired t tests, were used to assess statistical differences. All statistical analyses were carried out in GraphPad Prism 10 software. Specific statistical tests applied to individual data sets are specified in the corresponding figure legends. The number of individual biological replicates for all graphical representations are shown in the figure legends. All statistical analyses and exact P-values are included within the Source Data file.
Reporting summary
Further information on research design is available in theNature Portfolio Reporting Summary linked to this article.
